mental and physical exercise as a means to reverse cognitive aging and enhance well being

Lesson Study as a Means to Innovation for Good Practices in Teaching and Learning Mathematics in Vietnam

Lesson Study as a Means to Innovation for Good Practices in Teaching and Learning Mathematics in Vietnam

Ngày tải lên : 13/08/2015, 10:21
... different approach to teaching mathematics, but there are still many commonalities that can be shared, so that a realistic framework can be constructed which can help classroom teachers in each ASEAN ... instructional activities at both consideration and evaluation points were recorded and analysed There were thirteen mathematics teachers observed in the classes After observing the actual classes, a meeting ... improvements in teacher practice and the promotion of collaboration among teachers (Takahashi, 2006) In this research paper, a lesson study cycle was adopted that comprised four stages: planning → implementing...
  • 10
  • 319
  • 0
Báo cáo " Self-regulated strategy development as a means to foster learner autonomy in a writing course " pdf

Báo cáo " Self-regulated strategy development as a means to foster learner autonomy in a writing course " pdf

Ngày tải lên : 28/03/2014, 11:20
... (e.g Graham and Harris [19]; Mason, Harris and Graham [18]; Harris, Graham and Mason [20]; Chalk, Hagan-Burke and Burke [21]) Information collected at the earlier stage will be analyzed and taken ... evaluating the task - Timing: The evaluation will take place both during and after the task - Type of information: Information about students’ use and self-regulation of cognitive and metacognitive ... in language teaching and learning, Language Teaching 40 (2006) 21 [6] D Little, Language learner autonomy: Some fundamental considerations revisited, Innovation in Language Learning and Teaching...
  • 8
  • 518
  • 4
Báo cáo y học: "Using single nucleotide polymorphisms as a means to understanding the pathophysiology of asthma" pps

Báo cáo y học: "Using single nucleotide polymorphisms as a means to understanding the pathophysiology of asthma" pps

Ngày tải lên : 12/08/2014, 18:20
... Shirakawa I, Deichmann KA, Izuhara I, Mao I, Adra CN, Hopkin JM: Atopy and asthma: genetic variants of IL-4 and IL-13 signalling Immunol Today 2000, 21:60–64 105 Takabayashi A, Ihara K, Sasaki ... emphasis away from linkage analysis and microsatellite markers towards SNP genotyping and different analytical strategies based on association and haplotype analysis [31–34] Association analyses are ... Sasaki S, Adra CN, Kitaichi M, Inoue H, Yamauchi K, Tomichi N, Kurimoto F, Hamasaki N, Hopkin JM, Izuhara K, Shirakawa T, Deichmann KA: Genetic variants of IL-13 signalling and human asthma and...
  • 11
  • 491
  • 0
Law as a Means to an End  Threat to the Rule of Law  Law in Context

Law as a Means to an End Threat to the Rule of Law Law in Context

Ngày tải lên : 13/10/2016, 11:31
... operates in various ways: as an account of the nature of law, as an attitude toward law that professors teach students, as a form of constitutional analysis, as a theoretical perspective on law, ... law, as an orientation of lawyers in their daily practice, as a strategic approach of organized groups that use litigation to further their agendas, as a view toward judges and judging, as a perception ... contains a large measure of truth Law has always been used instrumentally to advance particular interests Even when it was characterized in non-instrumental terms, law regularly originated in and...
  • 269
  • 904
  • 0
Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot

Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot

Ngày tải lên : 30/03/2014, 15:20
... b-sandwich, a core (which contains a transamidation site and a Ca2+-binding site, and has a helices and b sheets in equal amounts), and two C-terminal b-barrel domains It has been suggested that glutamyl ... the coagulating gland [129] FXIII Coagulation FXIII is a plasma TG, and circulates in blood as a heterotetramer consisting of two catalytic A (XIIIA) and two noncatalytic B (XIIIB) subunits Table ... intracellular signalling and apoptosis, as well as in neurodegenerative and autoimmune diseases Consequently, its function may depend on its subcellular and cellular localization and on access to...
  • 17
  • 440
  • 0
a means to an end the biological basis of aging and death apr 1999

a means to an end the biological basis of aging and death apr 1999

Ngày tải lên : 11/06/2014, 05:26
... human death have changed dramatically during our history as a species, but maximum lifespan, as far as we can tell, has not As the twentieth century draws to a close, cardiovascular disease and ... menopause, whereas a female salmon may live only a day or two after spawning We assume that in a natural population, death from accidental causes will continue and perhaps even accelerate during this ... itself as a psychological toll of aging In terms of human morbidity and mortality, age-associated degenerative changes in the cardiovascular system are probably most critical, for the obvious reason...
  • 246
  • 670
  • 0
báo cáo hóa học:" Combined intermittent hypoxia and surface muscle electrostimulation as a method to increase peripheral blood progenitor cell concentration" pot

báo cáo hóa học:" Combined intermittent hypoxia and surface muscle electrostimulation as a method to increase peripheral blood progenitor cell concentration" pot

Ngày tải lên : 18/06/2014, 15:20
... and/ or assembly of data, data analysis and interpretation, manuscript writing; GMH: collection and/ or assembly of data, data analysis and interpretation, manuscript writing; CA: collection and/ or ... and/ or assembly of data, data analysis and interpretation, manuscript writing; RS: data analysis and interpretation, manuscript writing All authors read and approved the final manuscript Additional ... collection and/ or assembly of data, data analysis and interpretation, manuscript writing, final approval of manuscript; CJ: conception and design of the study, experimental subject, collection and/ or assembly...
  • 6
  • 426
  • 0
Module V Viruses and Worms.Introduction to VirusComputer viruses are perceived as a threat to potx

Module V Viruses and Worms.Introduction to VirusComputer viruses are perceived as a threat to potx

Ngày tải lên : 31/07/2014, 04:20
... and infect at later stages Attack Phase: • Some viruses have trigger events to activate and corrupt systems • Some viruses have bugs that replicate and perform activities like file deletion and ... the nature of attack • Draining of resources • Presence of bugs • Compatibility problems Ethical and Legal Reasons: • There are ethics and legalities that rule why virus and worms are damaging ... load than normal Computer's hard drive constantly runs out of free space Files have strange names which are not recognizable Programs act erratically Resources are used up easily Hardware Threats...
  • 38
  • 207
  • 0
Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt

Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt

Ngày tải lên : 11/08/2014, 00:23
... Journal of Obstetrics and Gynaecology, which has substantiated information about ovarian cancers and amenorrhea [8] In this way, continually organizing and updating information on an Ishikawa diagram ... relevant case reports and literatures are also indicated in the Ishikawa diagram so that readers can retrieve the case reports and relevant literatures easily The potential causes for secondary amenorrhea/oligomenorrhea ... diagram can cultivate lifelong learning habits in medical professionals Medical educators can also apply Ishikawa diagrams to facilitate problem-based learning when teaching medical students and...
  • 3
  • 381
  • 0
Báo cáo y học: " Exploring mentorship as a strategy to build capacity for knowledge translation research and practice: protocol for a qualitative study" pps

Báo cáo y học: " Exploring mentorship as a strategy to build capacity for knowledge translation research and practice: protocol for a qualitative study" pps

Ngày tải lên : 11/08/2014, 05:21
... Park, CA: Sage; 1990 Miles MB, Huberman AM: Qualitative analysis: an expanded sourcebook Thousand Oaks, CA: Sage Publications; 1994 Pope C, Ziebland S, Mays N: Analysing qualitative data Br Med ... according to recommendations that are based on the best available research Numerous population-based studies in Canada, Australia, the United Kingdom and United States demonstrate low compliance ... organizations in Canada and elsewhere to develop, implement, and evaluate mentorship for KT research and practice This research will establish a theoretical basis upon which we and others can...
  • 8
  • 592
  • 0
báo cáo khoa học: " Exploring mentorship as a strategy to build capacity for knowledge translation research and practice: protocol for a qualitative study" pot

báo cáo khoa học: " Exploring mentorship as a strategy to build capacity for knowledge translation research and practice: protocol for a qualitative study" pot

Ngày tải lên : 11/08/2014, 16:20
... Park, CA: Sage; 1990 Miles MB, Huberman AM: Qualitative analysis: an expanded sourcebook Thousand Oaks, CA: Sage Publications; 1994 Pope C, Ziebland S, Mays N: Analysing qualitative data Br Med ... according to recommendations that are based on the best available research Numerous population-based studies in Canada, Australia, the United Kingdom and United States demonstrate low compliance ... organizations in Canada and elsewhere to develop, implement, and evaluate mentorship for KT research and practice This research will establish a theoretical basis upon which we and others can...
  • 8
  • 317
  • 0
Báo cáo khoa học: "Tumor slices as a model to evaluate doxorubicin in vitro treatment and expression of trios of genes PRSS11, MTSS1, CLPTM1 and PRSS11, MTSS1, SMYD2 in canine mammary gland cancer" pptx

Báo cáo khoa học: "Tumor slices as a model to evaluate doxorubicin in vitro treatment and expression of trios of genes PRSS11, MTSS1, CLPTM1 and PRSS11, MTSS1, SMYD2 in canine mammary gland cancer" pptx

Ngày tải lên : 12/08/2014, 18:22
... treatment (Figure 2) TGCTTTCGGAGCGTATATC CCATGTTCAGGGTGTTCTCC GACTCCCTTCAGTGCTCCAG CCGGTAAGACTGGCTGATGT TGAGGGCCTTGTAAGTGAGC CACAAGGGCTGGTACTCCTG GCTTGTACATGCAGGACTGG CCGTGAGCCACTTCCATTAT GGGTCATCATCTCTGCTCCT ... http://www.actavetscand.com/content/50/1/27 Patients were evaluated by clinical history and physical examination including mammary tumor measurement and inguinal and axillary nodes palpation, performed ... Acta Veterinaria Scandinavica 2008, 50:27 Introduction Human and canine malignant mammary tumors share some epidemiological and clinicopathological features Incidence in both species increases...
  • 9
  • 337
  • 0
Báo cáo y học: " Factor correction as a tool to eliminate between-session variation in replicate experiments: application to molecular biology and retrovirology" ppsx

Báo cáo y học: " Factor correction as a tool to eliminate between-session variation in replicate experiments: application to molecular biology and retrovirology" ppsx

Ngày tải lên : 13/08/2014, 09:21
... Figure A: original data B: normalised data C: standardised data D: data after factor correction Note that normalisation, standardisation, and factor correction reduce the variation within each condition ... rection Comparison of normalisation, standardisation and factor corComparison of normalisation, standardisation and factor correction Mean (and SEM) of the data of the molecular-biology data set from ... constructs and in the molecular-biology data set is clearly larger after standardisation than after factor correction (cf Figs 2C and 2D) In factor correction, all available data are equally weighted...
  • 8
  • 304
  • 0
Báo cáo y học: "Submersion, accidental hypothermia and cardiac arrest, mechanical chest compressions as a bridge to final treatment: a case report" doc

Báo cáo y học: "Submersion, accidental hypothermia and cardiac arrest, mechanical chest compressions as a bridge to final treatment: a case report" doc

Ngày tải lên : 13/08/2014, 23:20
... Cardiopulmonary by-pass assistance was again considered, but still unavailable, why an IcyCath® catheter (Alsius Corp., CA, USA) was placed in the femoral vein for rewarming and temperature control ... speculated on; one reason may be that his airway was secured at an earlier time than patient The potential benefit of younger age in cases of accidental hypothermia and submersion has been addressed ... developed and repeated bronchoscopies revealed a general glassy oedema Still, the patient improved and at normothermia, sedation was reduced Two and a half days after the accident he regained consciousness...
  • 4
  • 205
  • 0
“Good” Legislation as a Means of Ensuring Voice, Accountability, and the Delivery of Results in Urban Development

“Good” Legislation as a Means of Ensuring Voice, Accountability, and the Delivery of Results in Urban Development

Ngày tải lên : 26/08/2016, 07:50
... understanding and application Especially in areas like urban legislation, where many active actors and stakeholders have a technical and nonlegal background, yet they assume an active role in legislating ... Make Legislation Easily Accessible Urban legislation concerns statutes dealing with ma ers as distinct as planning legislation, building standards, and management and governance issues Adding to ... connections amount to 104 percent of income per capita in Asia and the Pacific, 327 percent in Europe and Central Asia, and 850 percent in South Asia.20 Delays caused by complex and costly procedures are...
  • 14
  • 355
  • 0
Access to Finance and Markets as a Strategy to Address Poverty

Access to Finance and Markets as a Strategy to Address Poverty

Ngày tải lên : 30/08/2016, 15:25
... IFMR and Diviya Wahi, Shilpa Deshpande, and Anant Natu from ICICI Bank is gratefully acknowledged References Ananth, Bindu, Bastavee Barooah, Rupalee Ruchismita and Aparna Bhatnagar 2004 A Blueprint ... D I N G PA R AG R A P H S it has been argued that there exist a set of market-based approaches that have the potential to address poverty on a scaled basis At the heart of this approach is building ... research and product design capabilities both at a basic level and at an advanced level Launch of FINO, an Application Services Provider (ASP) that seeks to provide front-end (smart card, point-of-sale...
  • 4
  • 267
  • 0
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"

Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"

Ngày tải lên : 02/11/2012, 11:12
... mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and human influenza A ... infected fowls as demonstrated by the government of China, Vietnam, and Thailand As human populations continue to increase and interactions between animals and humans become more proximate, the emergence ... horses, seals, whales, and many types of birds as well as humans This can be a trans-species virus Type B infects only humans [8] Animals act as reservoirs for this influenza virus and Gelbalt [7]...
  • 4
  • 520
  • 0
Using eliciting question as a technique to teach english to 11th form pupils

Using eliciting question as a technique to teach english to 11th form pupils

Ngày tải lên : 27/12/2013, 20:26
... their own ideas, their information, their available knowledge and basing on that the learners can understand the lesson and practice using the language better 1.3 Summary This chapter has been concerned ... attractive and more interesting and make pupils more motivated Eliciting questions are also a mean to check up and to give teachersnecessaryinformation such as: which parts pupils have already ... understand the whole text such as a funny story Example: A tourist visiting a pub was fascinated by a stuffed lions head mounted on a mahogany plaque above a door behind the bar Is there a story...
  • 42
  • 641
  • 0
Tài liệu Learning Networks as a Means for Work Organization Development pptx

Tài liệu Learning Networks as a Means for Work Organization Development pptx

Ngày tải lên : 24/01/2014, 00:20
... communities are ready and willing to expand their role in an area in which they are forced in a constant search for a satisfying balance between their own scientific norms and standards and the expectations ... purchases and more reliable deliveries The core company has a special VAVE team and each supplier company has a VAVE coordinator External support for the Network’s discussions, training and development ... consultation, radiology, primary care, ophthalmology, transfer of ultrasound and digital transfer of ECG) in Lapland between the Sodankylä Health Care Centre, the Lapland Central Hospital and Oulu...
  • 17
  • 441
  • 0
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

Ngày tải lên : 18/02/2014, 16:20
... clinically important Fabry disease-associated a- galactosidase A variants (causing another lysosomal storage disease) were shown to be folding and trafficking mutants [16] before this was explored as ... ameliorate Gaucher disease 19 Fan JQ, Ishii S, Asano N & Suzuki Y (1999) Accelerated transport and maturation of lysosomal alpha-galactosidase A in Fabry lymphoblasts by an enzyme inhibitor Nat Med ... G328R variant, meaning that a heart transplant was no longer required [17] An active-sitedirected pharmacologic chaperone for a- galactosidase A discovered by Jian-Qiang Fan and developed by Amicus...
  • 7
  • 507
  • 0